KIAA1440

Product ID	ORK05521
Accession No	AB037861
Description	integrator complex subunit 1
Clone name	hg02441b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of SacI site to KpnI site of the vector.
cDNA sequence	DNA sequence (4434 bp) Predicted protein sequence (1377 aa)
Source	Human adult brain

Length: 4434 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	300 bp
Genome contig ID	gi89161213r_1376439
PolyA signal sequence (AATGAA,-21)	+--------+--------+----*----+---- CTGGGCTGGTTTTGAATGAAACGACCTGAACTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGTGCTCTCTGGTGTCCCATGTCGCCCTCTGGCCAGTGAGAGCCTCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	1476439	1493998	30	99.9	Perfect prediction

Length: 1377 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N201	99.9	Integrator comp...	Homo sapiens
Q6P4S8	86.9	Integrator comp...	Mus musculus
XP_001915173	87.2	integrator comp...	Equus caballus
XP_001367532	82.0	similar to Inte...	Monodelphis dom...
AAQ88846	99.9	HILV1821 [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GTCCAGCAAGCCCTCATTCAC
Primer_r	ACAGTTCAGGTCGTTTCATTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 7

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTCCAGCAAGCCCTCATTCAC
Primer_r	ACAGTTCAGGTCGTTTCATTC
PCR product length	105 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles