Gene/Protein Characteristic Table for KIAA0530
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07454
Accession No AB011102
Description zinc finger protein 292
Clone name hg02934
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6578 bp)
Predicted protein sequence (1563 aa)
Source Human adult brain
Rouge ID mKIAA0530 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6578 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1563 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60281 0 100.0 Zinc finger pro...
Homo sapiens
CAH73308 0 99.9 zinc finger pro...
Homo sapiens
EAW48608 0 99.9 hCG1640214, iso...
Homo sapiens
EAW48607 0 99.9 hCG1640214, iso...
Homo sapiens
XP_518625 0 99.6 zinc finger pro...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 787 812 PF00096 Zinc finger
IPR007087 1096 1121 PF00096 Zinc finger
HMMSmart IPR015880 215 235 SM00355 Zinc finger
IPR015880 742 767 SM00355 Zinc finger
IPR015880 787 812 SM00355 Zinc finger
IPR015880 954 979 SM00355 Zinc finger
IPR015880 1012 1037 SM00355 Zinc finger
IPR015880 1056 1081 SM00355 Zinc finger
IPR015880 1096 1121 SM00355 Zinc finger
IPR015880 1226 1250 SM00355 Zinc finger
ProfileScan IPR007087 215 242 PS50157 Zinc finger
IPR007087 787 812 PS50157 Zinc finger
IPR007087 954 984 PS50157 Zinc finger
IPR007087 1012 1042 PS50157 Zinc finger
IPR007087 1096 1126 PS50157 Zinc finger
ScanRegExp IPR007087 789 813 PS00028 Zinc finger
IPR007087 956 979 PS00028 Zinc finger
IPR007087 1014 1037 PS00028 Zinc finger
IPR007087 1058 1081 PS00028 Zinc finger
IPR007087 1098 1121 PS00028 Zinc finger
IPR007087 1228 1250 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GTAGAGGTTATTCCAGGAGAG
Primer_r TCAGAGTACCAGCGATTTCAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f GTAGAGGTTATTCCAGGAGAG
Primer_r TCAGAGTACCAGCGATTTCAG
PCR product length 286 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp