Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07454 |
---|---|
Accession No | AB011102 |
Description | zinc finger protein 292 |
Clone name | hg02934 |
Vector information | |
cDNA sequence | DNA sequence (6578 bp) Predicted protein sequence (1563 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0530
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 787 | 812 | PF00096 | Zinc finger |
IPR007087 | 1096 | 1121 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 215 | 235 | SM00355 | Zinc finger |
IPR015880 | 742 | 767 | SM00355 | Zinc finger | |
IPR015880 | 787 | 812 | SM00355 | Zinc finger | |
IPR015880 | 954 | 979 | SM00355 | Zinc finger | |
IPR015880 | 1012 | 1037 | SM00355 | Zinc finger | |
IPR015880 | 1056 | 1081 | SM00355 | Zinc finger | |
IPR015880 | 1096 | 1121 | SM00355 | Zinc finger | |
IPR015880 | 1226 | 1250 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 215 | 242 | PS50157 | Zinc finger |
IPR007087 | 787 | 812 | PS50157 | Zinc finger | |
IPR007087 | 954 | 984 | PS50157 | Zinc finger | |
IPR007087 | 1012 | 1042 | PS50157 | Zinc finger | |
IPR007087 | 1096 | 1126 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 789 | 813 | PS00028 | Zinc finger |
IPR007087 | 956 | 979 | PS00028 | Zinc finger | |
IPR007087 | 1014 | 1037 | PS00028 | Zinc finger | |
IPR007087 | 1058 | 1081 | PS00028 | Zinc finger | |
IPR007087 | 1098 | 1121 | PS00028 | Zinc finger | |
IPR007087 | 1228 | 1250 | PS00028 | Zinc finger |
RT-PCR |
---|
Primer_f | GTAGAGGTTATTCCAGGAGAG |
---|---|
Primer_r | TCAGAGTACCAGCGATTTCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTAGAGGTTATTCCAGGAGAG |
Primer_r | TCAGAGTACCAGCGATTTCAG |
PCR product length | 286 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |