KIAA0471

Product ID	ORK00083
Accession No	AB007940
Description	RAB GTPase activating protein 1-like, transcript variant 4
Clone name	hg03220
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6834 bp) Predicted protein sequence (413 aa)
HaloTag ORF Clone	FHC00083
Flexi ORF Clone	FXC00083
Source	Human adult brain
Rouge ID	mKIAA0471 by Kazusa Mouse cDNA Project

Length: 6834 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5309 bp
Genome contig ID	gi89161185f_172935741
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CCATTAAGCAGTAATAAACATTTGTTCTGAAGTCC
Flanking genome sequence (295328 - 295377)	----+--------+--------+--------+--------+----* ATGTATGTCTTTTTTATTTTTTTAGTTGACTTTATTCTGACTCATTTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	173035658	173231067	10	99.1	Perfect prediction

Length: 413 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI16277	1.4e-117	100.0	RAB GTPase acti...	Homo sapiens
AAI49458	1.3e-114	97.8	MGC157043 prote...	Bos taurus
BAE28037	2.8e-113	96.2	unnamed protein...	Mus musculus
BAA77334	1.1e-97	99.7	IDN4-GGTR9 [Hom...	Homo sapiens
BAA77330	1.1e-97	99.7	IDN4-GGTR6 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGGCTCACAAAAACAGTCACC
Primer_r	ATGACCAATTAGACGTTTCCG
PCR product length	236 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles