KIAA0556

Gene/Protein Characteristic Table for KIAA0556

Order Kazusa clone(s) from :

Product ID	ORK01093
Accession No	AB011128
Description	KIAA0556
Clone name	hg03732
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6618 bp) Predicted protein sequence (1625 aa)
HaloTag ORF Clone	FHC01093
Flexi ORF Clone	FXC01093
Source	Human adult brain
Rouge ID	mKIAA0556 by Kazusa Mouse cDNA Project
Note	We replaced hh00892, former representative clones for KIAA0556 with hg03732. (2001/5/29)

Features of the cloned cDNA sequence

Description

Length: 6618 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1739 bp
Genome contig ID	gi51511732f_27392722
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTCTTGCAAAATTAATAAAAGATGTTATTAAGAAT
Flanking genome sequence (306470 - 306519)	----+--------+--------+--------+--------+----* ATAGTCCGAGTCACCGGATTTGGGGTCAGATGGGGAGTCCATGCTGCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	27492718	27699190	27	100.0	Terminal No-hit

Features of the protein sequence

Description

Length: 1625 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056017	99.9	hypothetical pr...	Homo sapiens
XP_001094464	94.8	similar to K04F...	Macaca mulatta
XP_536927	76.5	similar to K04F...	Canis lupus fam...
AAI58020	72.8	RIKEN cDNA D430...	Mus musculus
EDL17335	70.4	mCG20545, isofo...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR002047	1220	1227	PS00256	Adipokinetic hormone

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	GTGTCGTGTTAGTGCCATCTC
Primer_r	TGTGACCCAAACCAGTGCCGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTGTCGTGTTAGTGCCATCTC
Primer_r	TGTGACCCAAACCAGTGCCGC
PCR product length	133 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp