|
Order Kazusa clone(s) from : |
| Product ID | ORK01093 |
|---|---|
| Accession No | AB011128 |
| Description | KIAA0556 |
| Clone name | hg03732 |
| Vector information | |
| cDNA sequence | DNA sequence (6618 bp) Predicted protein sequence (1625 aa) |
|
HaloTag ORF Clone |
FHC01093
|
| Flexi ORF Clone | FXC01093 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0556
by Kazusa Mouse cDNA Project
|
| Note | We replaced hh00892, former representative clones for KIAA0556 with hg03732. (2001/5/29) |
Length: 6618 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1739 bp |
|---|---|
| Genome contig ID | gi51511732f_27392722 |
| PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (306470 - 306519) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 16 | f | 27492718 | 27699190 | 27 | 100.0 | Terminal No-hit |
Length: 1625 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| ScanRegExp | IPR002047 | 1220 | 1227 | PS00256 | Adipokinetic hormone |
RT-PCR
|
|---|
Experimental conditions| Primer_f | GTGTCGTGTTAGTGCCATCTC |
|---|---|
| Primer_r | TGTGACCCAAACCAGTGCCGC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 16
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GTGTCGTGTTAGTGCCATCTC |
| Primer_r | TGTGACCCAAACCAGTGCCGC |
| PCR product length | 133 bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |