Gene/Protein Characteristic Table for KIAA1541
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06463
Accession No AB040974
Description protein phosphatase 2, regulatory subunit B, delta
Clone name hg04104
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6206 bp)
Predicted protein sequence (477 aa)
Source Human adult brain
Rouge ID mKIAA1541 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6206 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 477 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_521665 1.6e-184 93.9 protein phospha...
Pan troglodytes
CAI16703 2e-184 99.5 protein phospha...
Homo sapiens
Q66LE6 3.4e-184 99.5 Serine/threonin...
Homo sapiens
XP_001091436 1.4e-183 99.0 similar to prot...
Macaca mulatta
BAF85754 9.5e-183 98.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000009 65 85 PR00600 Protein phosphatase 2A
IPR000009 100 128 PR00600 Protein phosphatase 2A
IPR000009 129 157 PR00600 Protein phosphatase 2A
IPR000009 206 233 PR00600 Protein phosphatase 2A
IPR000009 234 261 PR00600 Protein phosphatase 2A
IPR000009 262 290 PR00600 Protein phosphatase 2A
IPR000009 291 318 PR00600 Protein phosphatase 2A
IPR000009 319 346 PR00600 Protein phosphatase 2A
IPR000009 347 372 PR00600 Protein phosphatase 2A
IPR000009 373 399 PR00600 Protein phosphatase 2A
IPR000009 443 472 PR00600 Protein phosphatase 2A
HMMSmart IPR001680 51 86 SM00320 WD40 repeat
IPR001680 113 153 SM00320 WD40 repeat
IPR001680 195 234 SM00320 WD40 repeat
IPR001680 245 285 SM00320 WD40 repeat
IPR001680 304 342 SM00320 WD40 repeat
IPR001680 369 400 SM00320 WD40 repeat
IPR001680 436 473 SM00320 WD40 repeat
ScanRegExp IPR000009 113 127 PS01024 Protein phosphatase 2A
IPR000009 204 218 PS01025 Protein phosphatase 2A
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACGAGATCAGTGTGGACAGTC
Primer_r AAATGTCCGGCTTAACTATGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 10
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp