Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06463 |
---|---|
Accession No | AB040974 |
Description | protein phosphatase 2, regulatory subunit B, delta |
Clone name | hg04104 |
Vector information | |
cDNA sequence | DNA sequence (6206 bp) Predicted protein sequence (477 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1541
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000009 | 65 | 85 | PR00600 | Protein phosphatase 2A |
IPR000009 | 100 | 128 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 129 | 157 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 206 | 233 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 234 | 261 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 262 | 290 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 291 | 318 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 319 | 346 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 347 | 372 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 373 | 399 | PR00600 | Protein phosphatase 2A | |
IPR000009 | 443 | 472 | PR00600 | Protein phosphatase 2A | |
HMMSmart | IPR001680 | 51 | 86 | SM00320 | WD40 repeat |
IPR001680 | 113 | 153 | SM00320 | WD40 repeat | |
IPR001680 | 195 | 234 | SM00320 | WD40 repeat | |
IPR001680 | 245 | 285 | SM00320 | WD40 repeat | |
IPR001680 | 304 | 342 | SM00320 | WD40 repeat | |
IPR001680 | 369 | 400 | SM00320 | WD40 repeat | |
IPR001680 | 436 | 473 | SM00320 | WD40 repeat | |
ScanRegExp | IPR000009 | 113 | 127 | PS01024 | Protein phosphatase 2A |
IPR000009 | 204 | 218 | PS01025 | Protein phosphatase 2A |
RT-PCR-ELISA |
Primer_f | ACGAGATCAGTGTGGACAGTC |
---|---|
Primer_r | AAATGTCCGGCTTAACTATGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |