KIAA0542

Product ID	ORK01089
Accession No	AB011114
Description	SFI1 centrin binding protein, transcript variant 2
Clone name	hg04325s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4160 bp) Predicted protein sequence (1212 aa)
HaloTag ORF Clone	FHC01089
Flexi ORF Clone	FXC01089
Source	Human adult brain
Rouge ID	mKIAA0542 by Kazusa Mouse cDNA Project
Note	We replaced hg04325, former representative clones for KIAA0542 with hg04325s1. (2002/5/10)

Length: 4160 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	131 bp
Genome contig ID	gi89161203f_30122261
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CAAAATGCTTTGCAATTAAATGAATTACTGTTCAG
Flanking genome sequence (222276 - 222325)	----+--------+--------+--------+--------+----* AAGTCTCCCACTTTTCATACAAAAATACTGTGCTACTGATACAGTTGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	30222261	30344535	32	99.9	Perfect prediction

Length: 1212 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11202	100.0	spindle assembl...	synthetic construct
EAW59980	99.9	Sfi1 homolog, s...	Homo sapiens
CAI12881	99.8	Sfi1 homolog, s...	Homo sapiens
XP_001148524	98.6	spindle assembl...	Pan troglodytes
CAI23034	99.8	Sfi1 homolog, s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CTGGGCCTGGACTTTCAACTG
Primer_r	GAGGTTCTGCTTGGTGGTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 22

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTGGGCCTGGACTTTCAACTG
Primer_r	GAGGTTCTGCTTGGTGGTCTG
PCR product length	101 (0.3k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles