Gene/Protein Characteristic Table for KIAA0624
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04929
Accession No AB014524
Description exophilin 5
Clone name hg04767
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6542 bp)
Predicted protein sequence (1983 aa)
Source Human adult brain
Rouge ID mKIAA0624 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6542 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1983 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8NEV8 0 99.9 Exophilin-5; Sy...
Homo sapiens
AAM44402 0 99.9 exophilin 5 [Ho...
Homo sapiens
NP_055880 0 99.8 exophilin 5 iso...
Homo sapiens
AAI17702 0 99.8 Exophilin 5 [Ho...
Homo sapiens
XP_001141449 0 98.6 exophilin 5 iso...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002322 3.2e-05 20.1 KIAA0324
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan IPR010911 1 57 PS50916 Rab-binding
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CACTGTCTGATTTGGGCTTTC
Primer_r TTACCCCACTGTTATCATCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name GeneBridge 4
Primer_f CACTGTCTGATTTGGGCTTTC
Primer_r TTACCCCACTGTTATCATCCC
PCR product length 201 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp