Order Kazusa clone(s) from : ![]() |
Product ID | ORK04897 |
---|---|
Accession No | AB002390 |
Description | ectonucleoside triphosphate diphosphohydrolase 4 |
Clone name | hh00034 |
Vector information | |
cDNA sequence | DNA sequence (5422 bp) Predicted protein sequence (550 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0392
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3769 bp |
---|---|
Genome contig ID | gi51511724r_23242621 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 23342621 | 23362231 | 11 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000407 | 22 | 483 | PF01150 | Nucleoside phosphatase GDA1/CD39 |
ScanRegExp | IPR000407 | 159 | 174 | PS01238 | Nucleoside phosphatase GDA1/CD39 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 497 | NHYLFSGCFLVVLLAILLYLLR | 518 | PRIMARY | 22 |
---|
![]() |
---|
Primer_f | GACCTTCCGAGAGTATTATTC |
---|---|
Primer_r | TGAATGATGTGACCAACCAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GACCTTCCGAGAGTATTATTC |
Primer_r | TGAATGATGTGACCAACCAAG |
PCR product length | 153 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |