KIAA0361

Product ID	ORK01073
Accession No	AB002359
Description	phosphoribosylformylglycinamidine synthase
Clone name	hh00072
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5338 bp) Predicted protein sequence (1371 aa)
HaloTag ORF Clone	FHC01073
Flexi ORF Clone	FXC01073
Source	Human adult brain
Rouge ID	mKIAA0361 by Kazusa Mouse cDNA Project

Length: 5338 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1221 bp
Genome contig ID	gi51511734f_7997902
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCCCGCCTTTTCAATAAAGGATGAATGAAGGTTG
Flanking genome sequence (116628 - 116677)	----+--------+--------+--------+--------+----* ACTGCATTGCCTGGGGTCCACAGATGGTGAGGGGGGCTGGGCGCACCCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	8093362	8114528	28	99.6	Perfect prediction

Length: 1371 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511854	99.1	phosphoribosylf...	Pan troglodytes
O15067	100.0	Phosphoribosylf...	Homo sapiens
EAW90068	99.9	phosphoribosylf...	Homo sapiens
NP_036525	99.7	phosphoribosylf...	Homo sapiens
BAF85493	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000728	292	467	PF00586	AIR synthase related protein
	IPR010918	477	636	PF02769	AIR synthase related protein
	IPR010918	880	1025	PF02769	AIR synthase related protein
HMMTigr	IPR010073	40	1366	TIGR01735	Phosphoribosylformylglycinamidine synthase

Primer_f	TTATTGAAAAGGCGGGGAGAG
Primer_r	CACTTACTGCATTGACTGTTG
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTATTGAAAAGGCGGGGAGAG
Primer_r	CACTTACTGCATTGACTGTTG
PCR product length	210 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles