Gene/Protein Characteristic Table for KIAA0363
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00060
Accession No AB002361
Description NAC alpha domain containing
Clone name hh00103
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4642 bp)
Predicted protein sequence (1522 aa)
Flexi ORF Clone FXC00060
Source Human adult brain
Rouge ID mKIAA0363 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4642 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1522 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15069 0 100.0 NAC-alpha domai...
Homo sapiens
XP_166571 0 99.9 NAC alpha domai...
Homo sapiens
BAG10323 0 100.0 NAC-alpha domai...
synthetic construct
XP_001717233 0 97.2 similar to NAC-...
Homo sapiens
EAW61057 0 97.2 hCG1640770 [Hom...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002715 1372 1431 PF01849 Nascent polypeptide-associated complex NAC
ProfileScan IPR002715 1371 1436 PS51151 Nascent polypeptide-associated complex NAC
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TTCCGGTCAGTGGCTACATGG
Primer_r CTGCGTGACATTGAGCTGGTG
PCR conditions 95 °C30 sec66 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name GeneBridge 4
Primer_f TTCCGGTCAGTGGCTACATGG
Primer_r CTGCGTGACATTGAGCTGGTG
PCR product length 130 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp