KIAA0367

Product ID	ORK04274
Accession No	AB002365
Description	prune homolog 2 (Drosophila)
Clone name	hh00141s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5656 bp) Predicted protein sequence (820 aa)
Source	Human adult brain
Rouge ID	mKIAA0367 by Kazusa Mouse cDNA Project
Note	We replaced hh00141, former representative clones for KIAA0367 with hh00141s1. (2002/5/10)

Length: 5656 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3193 bp
Genome contig ID	gi89161216r_78316113
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCACTGTATAATTCAGAAATAAAAATTGATTCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGATGGTTTTCTTTCTTTGAGTCAGCAAGAATTTTTCTCTGGCTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	78416113	78510217	12	99.6	Perfect prediction

Length: 820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA20822	100.0	kIAA0367 [Homo ...	Homo sapiens
BAD93351	99.9	BNIP2 motif con...	Homo sapiens
Q58A63	99.4	BNIP2 motif-con...	Homo sapiens
CAQ68519	98.8	prune homolog 2...	Homo sapiens
CAI39749	98.8	prune homolog 2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058775	7.2e-40	61.6	KIAA1872

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001251	630	785	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR001251	627	788	PS50191	Cellular retinaldehyde-binding/triple function

Primer_f	AAGGGAACAAACTACTGAGGC
Primer_r	ATGTTCTATGGGGTTACTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGGGAACAAACTACTGAGGC
Primer_r	ATGTTCTATGGGGTTACTCTC
PCR product length	153 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles