KIAA0494

Product ID	ORK05606
Accession No	AB007963
Description	EF-hand calcium binding domain 14
Clone name	hh00201
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5766 bp) Predicted protein sequence (536 aa)
HaloTag ORF Clone	FHC05606
Flexi ORF Clone	FXC05606
Source	Human adult brain

Length: 5766 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3301 bp
Genome contig ID	gi89161185r_46813420
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AATTTAGCTAAATAAAAAAATTTCTTTTTTCTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGTCTGACTAAAGCCTCTCTCACTCCCCTGCGATTTTTAAGGGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	46913420	46957323	11	99.2	Perfect prediction

Length: 536 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL30637	1.6e-127	74.3	RIKEN cDNA 4732...	Mus musculus
EDL90308	1.6e-117	82.4	similar to RIKE...	Rattus norvegicus
AAH59213	7.5e-113	79.6	RIKEN cDNA 4732...	Mus musculus
CAM15280	8.9e-113	73.0	novel protein [...	Mus musculus
BAC26732	1.4e-112	79.4	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR002048	475	510	PS50222	Calcium-binding EF-hand
ProfileScan	IPR002048	512	536	PS50222	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	112	ICYPLCGFVILAACVVACVGLVW	134	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	ACCAACGCCAACAACAACGTG
Primer_r	CAACTCTCGGCCACTCACACG
PCR product length	105 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles