Order Kazusa clone(s) from : ![]() |
Product ID | ORK05606 |
---|---|
Accession No | AB007963 |
Description | EF-hand calcium binding domain 14 |
Clone name | hh00201 |
Vector information | |
cDNA sequence | DNA sequence (5766 bp) Predicted protein sequence (536 aa) |
HaloTag ORF Clone |
FHC05606
![]() |
Flexi ORF Clone | FXC05606 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3301 bp |
---|---|
Genome contig ID | gi89161185r_46813420 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 46913420 | 46957323 | 11 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR002048 | 475 | 510 | PS50222 | Calcium-binding EF-hand |
IPR002048 | 512 | 536 | PS50222 | Calcium-binding EF-hand |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 112 | ICYPLCGFVILAACVVACVGLVW | 134 | PRIMARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCAACGCCAACAACAACGTG |
Primer_r | CAACTCTCGGCCACTCACACG |
PCR product length | 105 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |