Order Kazusa clone(s) from : ![]() |
Product ID | ORK00547 |
---|---|
Accession No | AB007948 |
Description | nicotinamide nucleotide adenylyltransferase 2, transcript variant 1 |
Clone name | hh00797 |
Vector information | |
cDNA sequence | DNA sequence (5431 bp) Predicted protein sequence (340 aa) |
HaloTag ORF Clone |
FHC00547
![]() |
Flexi ORF Clone | FXC00547 |
Source | Human adult brain |
Rouge ID |
mKIAA0479
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4407 bp |
---|---|
Genome contig ID | gi89161185r_181384001 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 181484001 | 181654125 | 11 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCACCAAGACCCACGTTATC |
Primer_r | ATCTGAATGTGCCCTTTGGTG |
PCR product length | 71 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |