KIAA1046

Product ID	ORK06248
Accession No	AB028969
Description	OTU deubiquitinase 4
Clone name	hh00940
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5577 bp) Predicted protein sequence (427 aa)
Source	Human adult brain
Rouge ID	mKIAA1046 by Kazusa Mouse cDNA Project

Length: 5577 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3794 bp
Genome contig ID	gi89161207r_146174253
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TAAAACTGTGTGCATATATTAAATTTTGTCTCTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGCTTGTGATTCTTTGGTTCCAGGGTTAACCAGGTAATATAGCATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	3820722	3825703	1	96.0	Terminal No-hit
Ensembl gnome browser	4	r	146274253	146279814	2	99.5	Internal No-hit

Length: 427 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH57242	1.3e-156	97.2	OTUD4 protein [...	Homo sapiens
ABD72605	2.2e-156	97.2	OTUD4: OTU doma...	Homo sapiens
AAI18573	2.2e-156	97.2	OTU domain cont...	Homo sapiens
Q01804	2.3e-156	97.2	OTU domain-cont...	Homo sapiens
XP_001095354	4.9e-155	96.0	similar to OTU ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	KPLFFLLFCLFNCFLSLQAYS	24	PRIMARY	21

Primer_f	ATGGCAGACCTAAGCTCAGAC
Primer_r	TGCACCAAGTCAATCATAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGGCAGACCTAAGCTCAGAC
Primer_r	TGCACCAAGTCAATCATAAGC
PCR product length	180 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles