KIAA0423

Product ID	ORK05600
Accession No	AB007883
Description	family with sequence similarity 179, member B
Clone name	hh01239s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6246 bp) Predicted protein sequence (1723 aa)
Source	Human adult brain
Rouge ID	mKIAA0423 by Kazusa Mouse cDNA Project
Note	We replaced hh01239, former representative clones for KIAA0423 with hh01239s1. (2002/5/10)

Length: 6246 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	869 bp
Genome contig ID	gi51511730f_44401161
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAGGAATGTTATAAAATAAAAGGATTTATTTCTTT
Flanking genome sequence (212224 - 212273)	----+--------+--------+--------+--------+----* AGATGTGTGAGAGGTGTCCTGTTTTTCCAACTTCCATACATGTTAAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	44501161	44613383	19	99.6	Perfect prediction

Length: 1723 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y4F4	99.9	Protein FAM179B.	Homo sapiens
XP_001150036	99.1	hypothetical pr...	Pan troglodytes
XP_001095589	97.3	similar to B002...	Macaca mulatta
XP_001076246	87.2	similar to B002...	Rattus norvegicus
XP_509925	96.1	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AGACCTGGCACTATTTTTGAG
Primer_r	AACCCCCCTATTTTTGTGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGACCTGGCACTATTTTTGAG
Primer_r	AACCCCCCTATTTTTGTGTGC
PCR product length	106 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles