|
Order Kazusa clone(s) from : |
| Product ID | ORK00074 |
|---|---|
| Accession No | AB007888 |
| Description | muscleblind-like splicing regulator 1, transcript variant 2 |
| Clone name | hh01409 |
| Vector information | |
| cDNA sequence | DNA sequence (5940 bp) Predicted protein sequence (373 aa) |
|
HaloTag ORF Clone |
FHC00074
|
| Flexi ORF Clone | FXC00074 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0428
by Kazusa Mouse cDNA Project
|
Length: 5940 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 373 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000571 | 17 | 43 | PF00642 | Zinc finger |
| IPR000571 | 51 | 75 | PF00642 | Zinc finger | |
| IPR000571 | 183 | 209 | PF00642 | Zinc finger | |
| IPR000571 | 219 | 243 | PF00642 | Zinc finger | |
| HMMSmart | IPR000571 | 17 | 43 | SM00356 | Zinc finger |
| IPR000571 | 50 | 75 | SM00356 | Zinc finger | |
| IPR000571 | 182 | 209 | SM00356 | Zinc finger | |
| IPR000571 | 219 | 243 | SM00356 | Zinc finger |
RT-PCR
|
|---|
Experimental conditions| Primer_f | AGCAGTCGGTAGAAGAAGCGG |
|---|---|
| Primer_r | CTTCCATCTCATGCGTTCAGC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 3
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | AGCAGTCGGTAGAAGAAGCGG |
| Primer_r | CTTCCATCTCATGCGTTCAGC |
| PCR product length | 208 bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |