Gene/Protein Characteristic Table for KIAA0610
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00108
Accession No AB011182
Description spastic paraplegia 20 (Troyer syndrome), transcript variant 1
Clone name hh01733b
Vector information
The cDNA fragment was inserted at the NotI site of the
cDNA sequence DNA sequence (3402 bp)
Predicted protein sequence (686 aa)
Flexi ORF Clone FXC00108
Source Human adult brain
Rouge ID mKIAA0610 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3402 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 686 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N0X7 0 100.0 Spartin; Trans-...
Homo sapiens
BAF84413 0 99.8 unnamed protein...
Homo sapiens
AAH47083 0 99.7 Spastic paraple...
Homo sapiens
XP_001083373 0 98.6 similar to spar...
Macaca mulatta
XP_534495 0 90.2 similar to spar...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR007330 36 114 SM00745 MIT
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AAGGCGCAGAAATGGAGCAAG
Primer_r TCTTTGCTTCTTCCTTCTGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 13
Experimental conditions
Panel name GeneBridge 4
Primer_f AAGGCGCAGAAATGGAGCAAG
Primer_r TCTTTGCTTCTTCCTTCTGAC
PCR product length 141 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp