KIAA0431

Product ID	ORK00075
Accession No	AB007891
Description	ATM interactor, transcript variant 2
Clone name	hh01739
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5350 bp) Predicted protein sequence (719 aa)
HaloTag ORF Clone	FHC00075
Flexi ORF Clone	FXC00075
Source	Human adult brain
Rouge ID	mKIAA0431 by Kazusa Mouse cDNA Project

Length: 5350 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2383 bp
Genome contig ID	gi51511732f_79531631
PolyA signal sequence (GATAAA,-21)	+--------+--------+----*----+---- TTTGAAAGCCATATGATAAAATGATTTTATTTAAT
Flanking genome sequence (106823 - 106872)	----+--------+--------+--------+--------+----* AATACCCAGTTATTTTCATTGTTTTTTCTTTTGTTCATGAAAATATGCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	79631631	79638452	3	99.0	Perfect prediction

Length: 719 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW95550	100.0	ATM/ATR-Substra...	Homo sapiens
AAH02701	100.0	ATMIN protein [...	Homo sapiens
O43313	100.0	ATM interactor;...	Homo sapiens
XP_001108829	97.1	similar to ATM/...	Macaca mulatta
BAF83632	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AGGGTACAATTCTGGCTTCTC
Primer_r	TAAATGGCAGTGATCTATGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGGGTACAATTCTGGCTTCTC
Primer_r	TAAATGGCAGTGATCTATGGC
PCR product length	191 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles