KIAA0562

Gene/Protein Characteristic Table for KIAA0562

Order Kazusa clone(s) from :

Product ID	ORK00097
Accession No	AB011134
Description	centrosomal protein 104kDa
Clone name	hh01779
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5848 bp) Predicted protein sequence (931 aa)
HaloTag ORF Clone	FHC00097
Flexi ORF Clone	FXC00097
Source	Human adult brain
Rouge ID	mKIAA0562 by Kazusa Mouse cDNA Project

Length: 5848 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2757 bp
Genome contig ID	gi89161185r_3618513
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- CACCCAGAGTATATTAATATAATAAAAAGATCACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGTTTTGTCACTTTATTTCAACATTACAATTAAAAAGTAATTTGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	3718513	3763611	23	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 931 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW71481	99.9	glycine-, gluta...	Homo sapiens
XP_001084851	97.1	glycine-, gluta...	Macaca mulatta
BAE29108	80.2	unnamed protein...	Mus musculus
XP_001076921	79.5	similar to glyc...	Rattus norvegicus
XP_001365476	74.7	similar to glyc...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	529	565	PF02985	HEAT
HMMPfam	IPR000357	610	646	PF02985	HEAT
ScanRegExp	IPR001005	454	462	PS00037	SANT

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	TGCTGGAACTGAGGTAGACAC
Primer_r	AGACTGTTTTTTGAGGGTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGCTGGAACTGAGGTAGACAC
Primer_r	AGACTGTTTTTTGAGGGTTGG
PCR product length	299 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp