KIAA0435

Product ID	ORK06297
Accession No	AB007895
Description	pecanex-like 2 (Drosophila)
Clone name	hh02241
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5347 bp) Predicted protein sequence (787 aa)
Source	Human adult brain
Rouge ID	mKIAA0435 by Kazusa Mouse cDNA Project

Length: 5347 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1818 bp
Genome contig ID	gi89161185r_231086505
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGTTCCAGAACACAGAACTGATCTCAGGTTTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAATCAAACAACAACAACAAAAAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	231186505	231260887	10	99.5	Perfect prediction

Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI22241	99.9	pecanex-like 2 ...	Homo sapiens
EAW69986	99.7	pecanex-like 2 ...	Homo sapiens
BAB84904	98.5	FLJ00149 protei...	Homo sapiens
XP_001103656	98.2	similar to peca...	Macaca mulatta
BAG51507	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018348	6.4e-98	53.0	KIAA0805

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007735	275	507	PF05041	Pecanex

Primer_f	CCTCGCAGCAAAGTGTGTCAG
Primer_r	CGGTATTGGTTGGTTGTGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCTCGCAGCAAAGTGTGTCAG
Primer_r	CGGTATTGGTTGGTTGTGGTG
PCR product length	129 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles