KIAA1049

Gene/Protein Characteristic Table for KIAA1049

Order Kazusa clone(s) from :

Product ID	ORK07077
Accession No	AB028972
Description	transcription factor 25 (basic helix-loop-helix)
Clone name	hh02614a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1794 bp) Predicted protein sequence (550 aa)
Source	Human adult brain
Rouge ID	mKIAA1049 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 1794 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	140 bp
Genome contig ID	gi51511732f_88379756
PolyA signal sequence (TATAAA,-18)	+--------+--------+----*----+---- TGGTCCACTGTTTCTCCTATAAATGTAAATGGGTC
Flanking genome sequence (125533 - 125582)	----+--------+--------+--------+--------+----* ACGCTCTGCCGTCCGCACCTTCTCCTTTCGCAGGCACTGAGCGCCGTCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	88478514	88505287	16	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BQ70	100.0	Transcription f...	Homo sapiens
XP_511180	99.6	NULP1 [Pan trog...	Pan troglodytes
EAW66677	99.8	NULP1, isoform ...	Homo sapiens
XP_001090795	96.2	similar to NULP...	Macaca mulatta
Q8R3L2	93.5	Transcription f...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006994	113	524	PF04910	Basic helix-loop-helix

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGACCGAAAAGCCGTATGATG
Primer_r	TAGGAGAAACAGTGGACCAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGACCGAAAAGCCGTATGATG
Primer_r	TAGGAGAAACAGTGGACCAGG
PCR product length	111 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp