KIAA0824

Product ID	ORK06290
Accession No	AB020631
Description	PCF11 cleavage and polyadenylation factor subunit
Clone name	hh02773
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5834 bp) Predicted protein sequence (1644 aa)
Source	Human adult brain
Rouge ID	mKIAA0824 by Kazusa Mouse cDNA Project

Length: 5834 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	897 bp
Genome contig ID	gi51511727f_82445861
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAATATTCATACATGTAATAAATAGAATGATGAAG
Flanking genome sequence (128622 - 128671)	----+--------+--------+--------+--------+----* AAACTTTGTTTGTACTTCTTTATTTCTTGAAAAGCTTTAGAATGTGACTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	82545861	82574481	16	100.0	Perfect prediction

Length: 1644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94913	100.0	Pre-mRNA cleava...	Homo sapiens
EAW75084	99.9	PCF11, cleavage...	Homo sapiens
XP_508673	94.3	pre-mRNA cleava...	Pan troglodytes
EDL06725	93.3	cleavage and po...	Mus musculus
NP_083354	93.3	pre-mRNA cleava...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058773	2.1e-09	33.2	KIAA1870
AB011108	0.0008	25.2	KIAA0536

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006569	106	228	SM00582	Regulation of nuclear pre-mRNA protein

Primer_f	TTCAAAAGGGGGTTCCGAGAG
Primer_r	ATACCTGGAGATGTGTTTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCAAAAGGGGGTTCCGAGAG
Primer_r	ATACCTGGAGATGTGTTTGTG
PCR product length	137 bp
PCR conditions	95 °C15 sec62 °C60 sec32 cycles