KIAA0642

Product ID	ORK01599
Accession No	AB014542
Description	GRB10 interacting GYF protein 2, transcript variant 1
Clone name	hh02837
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5937 bp) Predicted protein sequence (1329 aa)
HaloTag ORF Clone	FHC01599
Flexi ORF Clone	FXC01599
Source	Human adult brain
Rouge ID	mKIAA0642 by Kazusa Mouse cDNA Project
Note	We replaced hj03496, former representative clones for KIAA0642 with hh02837. (2002/5/10)

Length: 5937 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1748 bp
Genome contig ID	gi89161199f_233170300
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGCCAGTGTGGAGGAAAATAAAAAAGAACTTAAAT
Flanking genome sequence (261264 - 261313)	----+--------+--------+--------+--------+----* AAAATCTGATTGTATTCTATCTGAGTGCACCTCTTGTACTCACCTTTATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	233270300	233431562	31	100.0	Perfect prediction

Length: 1329 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46776	100.0	GIGYF2 protein ...	Homo sapiens
EAW71017	99.9	trinucleotide r...	Homo sapiens
XP_001147374	99.8	trinucleotide r...	Pan troglodytes
XP_850616	96.8	similar to trin...	Canis lupus fam...
Q6Y7W6	98.3	PERQ amino acid...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003169	564	619	PF02213	GYF
HMMSmart	IPR003169	564	619	SM00444	GYF
ProfileScan	IPR003169	563	611	PS50829	GYF

Primer_f	TTGCCTCCCTCCCTTCTAAAC
Primer_r	TAGGAGCCCCAACTTTTAATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTGCCTCCCTCCCTTCTAAAC
Primer_r	TAGGAGCCCCAACTTTTAATG
PCR product length	119 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles