KIAA0929

Product ID	ORK06961
Accession No	AB023146
Description	spen family transcriptional repressor
Clone name	hh03374
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6022 bp) Predicted protein sequence (1663 aa)
Source	Human adult brain
Rouge ID	mKIAA0929 by Kazusa Mouse cDNA Project

Length: 6022 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1028 bp
Genome contig ID	gi89161185f_16031324
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTGGATTACAAACTTTATTAAAAAATATAAAACAC
Flanking genome sequence (108215 - 108264)	----+--------+--------+--------+--------+----* ACCAAGTGTGAGTGTGATTGTCACTTGGGTGGGAGGACGAACCATGGGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	16131324	16139537	5	100.0	Perfect prediction

Length: 1663 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB51072	0	100.0	hypothetical pr...	Homo sapiens
BAG10400	0	100.0	spen homolog, t...	synthetic construct
Q96T58	0	100.0	Msx2-interactin...	Homo sapiens
EAW51756	0	99.9	spen homolog, t...	Homo sapiens
EDL80993	9.5e-214	77.1	rCG30673 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012921	1508	1629	PF07744	Spen paralogue and orthologue C-terminal
ProfileScan	IPR010912	1497	1663	PS50917	Spen paralogue and orthologue C-terminal

Primer_f	ACCCCTCTTCCTATTACCTTG
Primer_r	ACACAAAACAAAACTGCGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-