KIAA1155

Product ID	ORK00751
Accession No	AB032981
Description	poly(A) binding protein interacting protein 2B
Clone name	hh04176
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6286 bp) Predicted protein sequence (145 aa)
HaloTag ORF Clone	FHC00751
Flexi ORF Clone	FXC00751
Source	Human adult brain
Rouge ID	mKIAA1155 by Kazusa Mouse cDNA Project

Length: 6286 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5747 bp
Genome contig ID	gi89161199r_71063814
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCAGCTGTTGAGAATCTCAATAAAATGTTAAATGC
Flanking genome sequence (199563 - 199514)	----+--------+--------+--------+--------+----* ATTTGCTGGCAGTGGTACCCTTTTGCCTAAGGTTGGGTCACTGTGTTATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	71263377	71307721	4	99.0	Perfect prediction

Length: 145 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100423	1.7e-56	99.3	similar to Poly...	Macaca mulatta
XP_533009	5.3e-52	91.0	similar to Poly...	Canis lupus fam...
EAW99774	1.4e-48	99.2	hCG1988939, iso...	Homo sapiens
Q9ULR5	1e-47	100.0	Polyadenylate-b...	Homo sapiens
EDL91170	1.3e-42	88.7	similar to hypo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009818	127	144	PF07145	Ataxin-2

Primer_f	CAGGGGTAAGTGTCCGAAGTC
Primer_r	CAGCTCTTGAGGATGTTGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-