Gene/Protein Characteristic Table for KIAA1433
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00832
Accession No AB037854
Description CTTNBP2 N-terminal like
Clone name hh05535
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5671 bp)
Predicted protein sequence (652 aa)
Flexi ORF Clone FXC00832
Source Human adult brain
Rouge ID mKIAA1433 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5671 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 652 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW56515 1.5e-167 99.8 CTTNBP2 N-termi...
Homo sapiens
Q9P2B4 1.1e-166 100.0 CTTNBP2 N-termi...
Homo sapiens
Q5RDH2 2e-166 99.8 CTTNBP2 N-termi...
Pongo abelii
CAL38429 2.7e-166 99.8 hypothetical pr...
synthetic construct
BAG51087 3.7e-166 99.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051545 8.4e-16 40.4 KIAA1758
AB033101 1.6e-06 29.8 KIAA1275
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACCTCCCCAATCAAGTTCACC
Primer_r TCACGTTATCATACTCCAGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f ACCTCCCCAATCAAGTTCACC
Primer_r TCACGTTATCATACTCCAGAG
PCR product length 143 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp