KIAA0285

Product ID	ORK07156
Accession No	AB006623
Description	C2CD2-like
Clone name	hh10127a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2838 bp) Predicted protein sequence (658 aa)
Source	Human adult brain
Rouge ID	mKIAA0285 by Kazusa Mouse cDNA Project
Note	We replaced ha06864, former representative clones for KIAA0285 with hh10127a. (2002/5/10)

Length: 2838 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	860 bp
Genome contig ID	gi51511727f_118383805
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTGGAATTTAATTTATTAAAGTCAAATTGGAGTTT
Flanking genome sequence (109233 - 109282)	----+--------+--------+--------+--------+----* ATAAACTGGACAACTGGTTATCCTTTGAAAGGCAGTAGGCAGCCAGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	118483805	118493036	14	100.0	Perfect prediction

Length: 658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O14523	100.0	C2 domain-conta...	Homo sapiens
XP_508807	99.7	transmembrane p...	Pan troglodytes
BAC76048	99.7	DLNB23 [Homo sa...	Homo sapiens
XP_001164505	99.4	transmembrane p...	Pan troglodytes
XP_001102496	98.2	transmembrane p...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 11

Experimental conditions

Panel name	Genebridge 4
Primer_f	ATGCTCCTGTCCACACTACTC
Primer_r	GTTCACTATTTGGGCGATGCG
PCR product length	193 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles