KIAA1159

Gene/Protein Characteristic Table for KIAA1159

Order Kazusa clone(s) from :

Product ID	ORK06216
Accession No	AB032985
Description	neurexophilin 3
Clone name	hj00357
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5194 bp) Predicted protein sequence (221 aa)
Source	Human adult brain
Rouge ID	mKIAA1159 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5194 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4527 bp
Genome contig ID	gi51511734f_44910995
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATGAGTTGCTCAATAAATGTTACTTCCTCCTGTC
Flanking genome sequence (105195 - 105244)	----+--------+--------+--------+--------+----* TTTTTTTTTCTAAGATGGGTTGTTGTTAACCTTGGCCTTGCTCCTGGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	45010995	45016188	1	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 221 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O95157	1.4e-91	100.0	Neurexophilin-3...	Homo sapiens
AAH22541	5.1e-91	99.5	Neurexophilin 3...	Homo sapiens
XP_001093691	2.2e-90	98.2	similar to Neur...	Macaca mulatta
XP_851450	3.6e-89	97.3	similar to Neur...	Canis lupus fam...
XP_001502469	4.7e-88	95.9	similar to Neur...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010450	1	221	PF06312	Neurexophilin

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TTCCAAAGATTCCGAGTCCTG
Primer_r	AGGTCTCTGCTGGCATTTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TTCCAAAGATTCCGAGTCCTG
Primer_r	AGGTCTCTGCTGGCATTTGTG
PCR product length	186 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp