KIAA0595

Product ID	ORK00105
Accession No	AB011167
Description	peroxisome proliferator-activated receptor gamma, coactivator-related 1, transcript variant 1
Clone name	hj02929s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5297 bp) Predicted protein sequence (1666 aa)
HaloTag ORF Clone	FHC00105
Flexi ORF Clone	FXC00105
Source	Human adult brain
Rouge ID	mKIAA0595 by Kazusa Mouse cDNA Project
Note	We replaced hj02929, former representative clones for KIAA0595 with hj02929s1. (2002/5/10)

Length: 5297 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	295 bp
Genome contig ID	gi89161187f_103782809
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTCACTATGCAGACTAATAAACATCAACTAGAGAG
Flanking genome sequence (117264 - 117313)	----+--------+--------+--------+--------+----* AACTCCCAACTGCTGTTGTGCGTCTTTATATGGTGCTAATGCCAAATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	103882809	103900071	14	100.0	Perfect prediction

Length: 1666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5VV67	100.0	Peroxisome prol...	Homo sapiens
AAH63829	99.9	Peroxisome prol...	Homo sapiens
AAK11573	99.8	PGC-1 related c...	Homo sapiens
EAW49719	99.7	peroxisome prol...	Homo sapiens
EAW49720	99.6	peroxisome prol...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	1547	1608	PF00076	RNA recognition motif
HMMSmart	IPR000504	1546	1617	SM00360	RNA recognition motif
ProfileScan	IPR000504	1545	1621	PS50102	RNA recognition motif

Primer_f	GCTTCGTCACTTATCGCTATG
Primer_r	ATCAAAGGGCTGCTCATCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GCTTCGTCACTTATCGCTATG
Primer_r	ATCAAAGGGCTGCTCATCTGC
PCR product length	89 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles