KIAA0643

Product ID	ORK04588
Accession No	AB014543
Description	clusterin associated protein 1
Clone name	hj03545
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5127 bp) Predicted protein sequence (403 aa)
Source	Human adult brain
Rouge ID	mKIAA0643 by Kazusa Mouse cDNA Project

Length: 5127 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3913 bp
Genome contig ID	gi51511732f_3391019
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TCACAATACCAAGCATTAAATGTATTTTAATAACT
Flanking genome sequence (135809 - 135858)	----+--------+--------+--------+--------+----* AAACTTTTCTGAAAGAAGGTTAGCTAAAGTTAAATGAAAACTTGGTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	3491019	3526826	11	99.2	Perfect prediction

Length: 403 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW85352	1.5e-129	100.0	clusterin assoc...	Homo sapiens
XP_001167227	6.3e-129	99.5	clusterin assoc...	Pan troglodytes
AAH17070	6.5e-121	100.0	Clusterin assoc...	Homo sapiens
Q96AJ1	6.5e-121	100.0	Clusterin-assoc...	Homo sapiens
XP_001167259	9.8e-121	98.4	clusterin assoc...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TAAGAGCTGACGCCACACAAG
Primer_r	CAGATGTTCCCCTACGATTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TAAGAGCTGACGCCACACAAG
Primer_r	CAGATGTTCCCCTACGATTCC
PCR product length	125 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles