Gene/Protein Characteristic Table for KIAA0648
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06318
Accession No AB014548
Description PDS5 cohesin associated factor A
Clone name hj03994
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5177 bp)
Predicted protein sequence (851 aa)
Source Human adult brain
Rouge ID mKIAA0648 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5177 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 851 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAM82347 0 100.0 SCC-112 [Homo s...
Homo sapiens
CAH18263 0 100.0 hypothetical pr...
Homo sapiens
Q29RF7 0 100.0 Sister chromati...
Homo sapiens
EAW92955 0 100.0 SCC-112 protein...
Homo sapiens
XP_526554 0 100.0 SCC-112 protein...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023196 4.5e-150 62.3 KIAA0979
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f AGAAGTCCCTCAAGCAATCAG
Primer_r TGACACACTGGAAACCTTAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f AGAAGTCCCTCAAGCAATCAG
Primer_r TGACACACTGGAAACCTTAGG
PCR product length 99 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp