KIAA1135

Product ID	ORK00747
Accession No	AB032961
Description	spire-type actin nucleation factor 1, transcript variant 1
Clone name	hj05037
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5495 bp) Predicted protein sequence (789 aa)
HaloTag ORF Clone	FHC00747
Flexi ORF Clone	FXC00747
Source	Human adult brain
Rouge ID	mKIAA1135 by Kazusa Mouse cDNA Project
Note	We replaced hj02644, former representative clones for KIAA1135 with hj05037. (2002/5/10)

Length: 5495 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3125 bp
Genome contig ID	gi51511735r_12336512
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAAATTTAGAGAAAAATAAAATGGCTTTCCATCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTCTGTGTTGAGTTGCTATCGTAAGACGGTGATGTCTTTTGGTAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	12436512	12647964	17	99.4	Perfect prediction

Length: 789 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09977	0	100.0	spire homolog 1...	synthetic construct
Q08AE8	0	99.9	Protein spire h...	Homo sapiens
XP_547684	4.7e-210	94.5	similar to spir...	Canis lupus fam...
AAI25207	1.6e-208	100.0	SPIRE1 protein ...	Homo sapiens
AAH58669	2.5e-196	92.6	SPIRE1 protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058735	1.1e-54	42.9	KIAA1832

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR011019	73	264	SM00750	KIND

Primer_f	GCATTACGATCACCTCTTACC
Primer_r	ACTTTAACTGTGCCATGTGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-