KIAA1162

Gene/Protein Characteristic Table for KIAA1162

Order Kazusa clone(s) from :

Product ID	ORK07256
Accession No	AB032988
Description	thioredoxin-related transmembrane protein 4
Clone name	hj05107
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5224 bp) Predicted protein sequence (115 aa)
Source	Human adult brain
Rouge ID	mKIAA1162 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5224 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4875 bp
Genome contig ID	gi51511747r_7806024
PolyA signal sequence (None)	+--------+--------+----*----+---- CCATTTGCCTAGGCAGCAAAAAATATTAATTTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAATTTTCCTTCGTGTCCATCCTCCATCTAGTCTGTTCATTCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	7906024	7911246	1	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB56344	6e-34	100.0	hypothetical pr...	Homo sapiens
XP_001167731	8.7e-34	100.0	thioredoxin dom...	Pan troglodytes
Q9H1E5	9.3e-34	100.0	Thioredoxin dom...	Homo sapiens
BAC11237	2.6e-33	99.1	unnamed protein...	Homo sapiens
AAH33787	3.8e-33	99.1	Thioredoxin dom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AACATACAGGCAATCCACATC
Primer_r	AATGTATAGAGCTAAAGAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 20

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp