KIAA1018

Product ID	ORK01143
Accession No	AB023235
Description	FANCD2/FANCI-associated nuclease 1, transcript variant 1
Clone name	hj06112
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4835 bp) Predicted protein sequence (1040 aa)
HaloTag ORF Clone	FHC01143
Flexi ORF Clone	FXC01143
Source	Human adult brain
Rouge ID	mKIAA1018 by Kazusa Mouse cDNA Project
Note	We replaced hk10468, former representative clones for KIAA1018 with hj06112. (2004/1/10)

Length: 4835 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1543 bp
Genome contig ID	gi51511731f_28883421
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCCTGCAAAATAAATAAATAAATATTTGCAAAACT
Flanking genome sequence (139181 - 139230)	----+--------+--------+--------+--------+----* AAAGATTCTCTCATGAATGCCTTTTTTCAGATGAGCCACTCATCATTACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	28983421	29022600	15	99.6	Perfect prediction

Length: 1040 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11275	100.0	myotubularin-re...	synthetic construct
XP_001109813	94.8	similar to C01G...	Macaca mulatta
XP_001491319	81.0	similar to Coil...	Equus caballus
Q69ZT1	71.2	Coiled-coil dom...	Mus musculus
XP_219706	70.7	similar to C01G...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014883	916	1031	PF08774	VRR-NUC
HMMSmart	IPR006642	64	88	SM00734	Zinc finger

Primer_f	GTGTTTGGTTACGTGTGAGCC
Primer_r	CTACATTGGAAAGAGCACACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTGTTTGGTTACGTGTGAGCC
Primer_r	CTACATTGGAAAGAGCACACC
PCR product length	114 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles