KIAA0964

Product ID	ORK00700
Accession No	AB023181
Description	discs, large (Drosophila) homolog-associated protein 4, transcript variant 1
Clone name	hj06154
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5007 bp) Predicted protein sequence (999 aa)
HaloTag ORF Clone	FHC00700
Flexi ORF Clone	FXC00700
Source	Human adult brain
Rouge ID	mKIAA0964 by Kazusa Mouse cDNA Project

Length: 5007 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1602 bp
Genome contig ID	gi51511747f_34328858
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAGGCATGTTGTGAGAATAAATGAGGTAACGTGTA
Flanking genome sequence (261594 - 261643)	----+--------+--------+--------+--------+----* CCAAGGGCTTGTGGCATTATTGCAGGGGGATGAGCAGAGTGGGCCCAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	34357717	34590450	13	99.4	Perfect prediction

Length: 999 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09920	100.0	disks large-ass...	synthetic construct
CAI17928	99.9	discs, large (D...	Homo sapiens
XP_001095952	99.7	similar to disk...	Macaca mulatta
XP_001135968	99.7	disks large-ass...	Pan troglodytes
XP_001502031	97.6	discs, large (D...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13633	0.00023	25.4	KIAA0008

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005026	663	999	PF03359	Guanylate-kinase-associated protein

Primer_f	CACCGCTGAGCAGATGAGAGA
Primer_r	TTTGCTGAAGGAAGAAGGGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-