KIAA1393

Gene/Protein Characteristic Table for KIAA1393

Order Kazusa clone(s) from :

Product ID	ORK07215
Accession No	AB037814
Description	tRNA methyltransferase 5
Clone name	hj06562
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5164 bp) Predicted protein sequence (500 aa)
Source	Human adult brain
Rouge ID	mKIAA1393 by Kazusa Mouse cDNA Project

Length: 5164 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3659 bp
Genome contig ID	gi51511730r_60407922
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAGTATCTTTAATAAAGCTGGATACAGTTTGAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAGTGTGGCAATTTGTTTTAGCTTGTTCTGTAAGTACCTACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	60507922	60516343	4	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI08285	1.4e-206	99.8	TRM5 tRNA methy...	Homo sapiens
Q32P41	7.1e-206	99.6	tRNA (guanine-N...	Homo sapiens
XP_522871	2.9e-205	99.2	tRNA-(N1G37) me...	Pan troglodytes
XP_001097647	4.7e-196	93.8	similar to tRNA...	Macaca mulatta
XP_001097447	4.9e-196	93.8	similar to tRNA...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003402	189	410	PF02475	Protein of unknown function Met10

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GACATCTGTTGGGACCTGACC
Primer_r	GCTCTTTTGACAGGTGCCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TAGCTTGGACATCCCTGACAC
Primer_r	GTGTTTCTGTTTCTGGCATGG
PCR product length	99 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp