KIAA0971

Gene/Protein Characteristic Table for KIAA0971

Order Kazusa clone(s) from :

Product ID	ORK00704
Accession No	AB023188
Description	FAST kinase domains 2
Clone name	hj06832
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4999 bp) Predicted protein sequence (665 aa)
Source	Human adult brain
Rouge ID	mKIAA0971 by Kazusa Mouse cDNA Project

Length: 4999 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2994 bp
Genome contig ID	gi89161199f_207239611
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- CCTCAGTTCACTATTAAAATTAATTTTAGGAGTGG
Flanking genome sequence (125306 - 125355)	----+--------+--------+--------+--------+----* AAGAAATGTTGTTACTGCCATTTAAAAATATGCTGAGAAAATTCCAGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	207339604	207364915	9	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 665 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG50930	0	99.7	unnamed protein...	Homo sapiens
Q5R776	0	95.1	FAST kinase dom...	Pongo abelii
BAE87402	0	90.1	unnamed protein...	Macaca fascicularis
BAE01306	0	89.1	unnamed protein...	Macaca fascicularis
EDL00192	3.3e-177	63.6	FAST kinase dom...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	473	545	PF06743	FAST kinase leucine-rich
HMMPfam	IPR013579	552	636	PF08368	FAST kinase-like protein

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGGGAGATGGACAAACTAGAG
Primer_r	TTACAGCAGCAACAGGAAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 2

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGGGAGATGGACAAACTAGAG
Primer_r	TTACAGCAGCAACAGGAAGAG
PCR product length	91 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp