KIAA0979

Product ID	ORK01619
Accession No	AB023196
Description	PDS5 cohesin associated factor B
Clone name	hj07056s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5309 bp) Predicted protein sequence (1483 aa)
HaloTag ORF Clone	FHC01619
Flexi ORF Clone	FXC01619
Source	Human adult brain
Rouge ID	mKIAA0979 by Kazusa Mouse cDNA Project
Note	We replaced hj07056, former representative clones for KIAA0979 with hj07056s1. (2002/5/10)

Length: 5309 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	857 bp
Genome contig ID	gi51511729f_31958651
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATCTACTGTATCAATAAAATTCTGTAATTTGAATG
Flanking genome sequence (289394 - 289443)	----+--------+--------+--------+--------+----* AGTTTTTAATAGTCTAGAATGTTATTGTGTATAGATATTTCCTCTTGAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	32058642	32248043	35	99.8	Perfect prediction

Length: 1483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001118201	99.3	similar to andr...	Macaca mulatta
XP_543139	98.7	similar to andr...	Canis lupus fam...
XP_509623	99.2	androgen-induce...	Pan troglodytes
Q9NTI5	100.0	Sister chromati...	Homo sapiens
Q6TRW4	96.3	Sister chromati...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014548	2.4e-97	62.5	KIAA0648

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	419	455	PF02985	HEAT
HMMPfam	IPR000637	1408	1420	PF02178	HMG-I and HMG-Y

Primer_f	TGATGTCACTATTTGTTGGAG
Primer_r	TTGCATGGTTGTCCTCCTATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-