KIAA0980

Product ID	ORK00707
Accession No	AB023197
Description	ninein-like
Clone name	hj07083
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4848 bp) Predicted protein sequence (1406 aa)
HaloTag ORF Clone	FHC00707
Flexi ORF Clone	FXC00707
Source	Human adult brain
Rouge ID	mKIAA0980 by Kazusa Mouse cDNA Project

Length: 4848 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	625 bp
Genome contig ID	gi51511747r_25281462
PolyA signal sequence (None)	+--------+--------+----*----+---- TGAAATGTCATCACACTGGAAATTGTACTATATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGTATAGTTTTATATTTGAAATGTATGCAAATTATGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	25381462	25514153	24	100.0	Perfect prediction

Length: 1406 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2I6	0	100.0	Ninein-like pro...	Homo sapiens
AAH36380	0	99.7	Ninein-like [Ho...	Homo sapiens
ACE78295	0	74.7	ninein-like pro...	Homo sapiens
XP_230778	2.8e-203	60.2	similar to plec...	Rattus norvegicus
CAM17134	8.2e-200	60.0	novel protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046785	2.5e-28	30.1	KIAA1565
AB007914	2.5e-05	24.0	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	237	282	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002048	35	63	PF00036	Calcium-binding EF-hand
HMMPfam	IPR002048	261	289	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	35	63	SM00054	Calcium-binding EF-hand
	IPR002048	224	252	SM00054	Calcium-binding EF-hand
	IPR002048	261	289	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	31	66	PS50222	Calcium-binding EF-hand
	IPR002048	84	100	PS50222	Calcium-binding EF-hand
	IPR002048	220	255	PS50222	Calcium-binding EF-hand
	IPR002048	257	292	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	270	282	PS00018	Calcium-binding EF-hand

Primer_f	TTTGCCATTTCACTGTTCTGC
Primer_r	AGTCCACAGATAAGGTCCCCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTTGCCATTTCACTGTTCTGC
Primer_r	AGTCCACAGATAAGGTCCCCG
PCR product length	154 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles