KIAA1268

Product ID	ORK06272
Accession No	AB033094
Description	poly (ADP-ribose) polymerase family, member 14
Clone name	hj07379
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5231 bp) Predicted protein sequence (1023 aa)
Source	Human adult brain
Rouge ID	mKIAA1268 by Kazusa Mouse cDNA Project

Length: 5231 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2159 bp
Genome contig ID	gi89161205f_123802063
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAAGGTGCCTCCATGGAGGTCCCTAGAATTGTG
Flanking genome sequence (122123 - 122172)	----+--------+--------+--------+--------+----* AAAATAACATAAAAAATGGGTGGTCTGTCATCCTCTATGACTATTATGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	123902063	123924184	10	99.4	Perfect prediction

Length: 1023 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAY64450	100.0	B-aggressive ly...	Homo sapiens
EAW79467	99.9	poly (ADP-ribos...	Homo sapiens
EAW79470	99.1	poly (ADP-ribos...	Homo sapiens
AAY64449	99.1	B-aggressive ly...	Homo sapiens
Q460N5	99.1	Poly [ADP-ribos...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002589	163	280	PF01661	Appr-1-p processing
	IPR002589	375	491	PF01661	Appr-1-p processing
	IPR002589	588	690	PF01661	Appr-1-p processing
	IPR004170	866	944	PF02825	WWE
HMMSmart	IPR002589	146	280	SM00506	Appr-1-p processing
	IPR002589	358	491	SM00506	Appr-1-p processing
	IPR002589	571	690	SM00506	Appr-1-p processing
ProfileScan	IPR002589	134	321	PS51154	Appr-1-p processing
	IPR002589	346	533	PS51154	Appr-1-p processing
	IPR002589	559	730	PS51154	Appr-1-p processing
	IPR004170	866	944	PS50918	WWE

Primer_f	GAACTTGAACACATACACTGC
Primer_r	CTGATTAAACTTGCTTGCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAACTTGAACACATACACTGC
Primer_r	CTGATTAAACTTGCTTGCCAC
PCR product length	181(1.6k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles