Gene/Protein Characteristic Table for KIAA1268
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06272
Accession No AB033094
Description poly (ADP-ribose) polymerase family, member 14
Clone name hj07379
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5231 bp)
Predicted protein sequence (1023 aa)
Source Human adult brain
Rouge ID mKIAA1268 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5231 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2159 bp
Genome contig ID gi89161205f_123802063
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTAAGGTGCCTCCATGGAGGTCCCTAGAATTGTG
Flanking genome sequence
(122123 - 122172)
----+----*----+----*----+----*----+----*----+----*
AAAATAACATAAAAAATGGGTGGTCTGTCATCCTCTATGACTATTATGTC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 3 f 123902063 123924184 10 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 1023 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAY64450 0 100.0 B-aggressive ly...
Homo sapiens
EAW79467 0 99.9 poly (ADP-ribos...
Homo sapiens
EAW79470 0 99.1 poly (ADP-ribos...
Homo sapiens
AAY64449 0 99.1 B-aggressive ly...
Homo sapiens
Q460N5 0 99.1 Poly [ADP-ribos...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002589 163 280 PF01661 Appr-1-p processing
IPR002589 375 491 PF01661 Appr-1-p processing
IPR002589 588 690 PF01661 Appr-1-p processing
IPR004170 866 944 PF02825 WWE
HMMSmart IPR002589 146 280 SM00506 Appr-1-p processing
IPR002589 358 491 SM00506 Appr-1-p processing
IPR002589 571 690 SM00506 Appr-1-p processing
ProfileScan IPR002589 134 321 PS51154 Appr-1-p processing
IPR002589 346 533 PS51154 Appr-1-p processing
IPR002589 559 730 PS51154 Appr-1-p processing
IPR004170 866 944 PS50918 WWE
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GAACTTGAACACATACACTGC
Primer_r CTGATTAAACTTGCTTGCCAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f GAACTTGAACACATACACTGC
Primer_r CTGATTAAACTTGCTTGCCAC
PCR product length 181(1.6k) bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp