KIAA1083

Product ID	ORK00733
Accession No	AB029006
Description	spastin, transcript variant 2
Clone name	hj07423
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5120 bp) Predicted protein sequence (584 aa)
HaloTag ORF Clone	FHC00733
Flexi ORF Clone	FXC00733
Source	Human adult brain
Rouge ID	mKIAA1083 by Kazusa Mouse cDNA Project

Length: 5120 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3144 bp
Genome contig ID	gi89161199f_32042184
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTATCCTAATGTATTGGAAATAAATGATAAACTTT
Flanking genome sequence (194027 - 194076)	----+--------+--------+--------+--------+----* ATTTTGTCTTTACTTTTTTACTTTAAAACTTTTTGATATTTTAGGGGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	32142184	32236209	16	99.4	Perfect prediction

Length: 584 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_862831	1.6e-175	94.9	similar to spas...	Canis lupus fam...
AAI66846	2.7e-169	93.8	Spast protein [...	Rattus norvegicus
XP_001371530	4.4e-150	90.3	similar to spas...	Monodelphis dom...
ACF60961	1.7e-131	87.9	neuronal spasti...	Gallus gallus
Q9UBP0	8.8e-118	94.8	Spastin.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003959	345	530	PF00004	AAA ATPase
HMMSmart	IPR007330	116	194	SM00745	MIT
HMMSmart	IPR003593	342	478	SM00382	AAA+ ATPase
ScanRegExp	IPR003960	448	467	PS00674	AAA ATPase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	55	YPLFVGFALLRLVAFHLGLLFVW	77	PRIMARY	23

Primer_f	TCGGTGTTGAGCTCTGTGTTG
Primer_r	ACTCATTCTTTCCCTTGGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCGGTGTTGAGCTCTGTGTTG
Primer_r	ACTCATTCTTTCCCTTGGCTC
PCR product length	151 bp
PCR conditions	95 °C15 sec64 °C60 sec35 cycles