KIAA1394

Product ID	ORK00824
Accession No	AB037815
Description	carnosine synthase 1
Clone name	hj07546
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5065 bp) Predicted protein sequence (1003 aa)
HaloTag ORF Clone	FHC00824
Flexi ORF Clone	FXC00824
Source	Human adult brain
Rouge ID	mKIAA1394 by Kazusa Mouse cDNA Project

Length: 5065 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1004 bp
Genome contig ID	gi51511727f_66840243
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GCATCCCTCCCCAAATAAAGGCTTATGTACTGGTG
Flanking genome sequence (109411 - 109460)	----+--------+--------+--------+--------+----* AAGTGTCTAGATAGGTTCTCTTGACTGGACAACTCCTCCCAGGATCAGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	66940243	66949652	8	100.0	Perfect prediction

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_065862	100.0	ATP-grasp domai...	Homo sapiens
A5YM72	99.9	ATP-grasp domai...	Homo sapiens
EDL33027	83.0	mCG3875 [Mus mu...	Mus musculus
XP_001378878	75.6	similar to hCG2...	Monodelphis dom...
Q6ZPS2	84.0	ATP-grasp domai...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003806	677	873	PF02655	ATP-grasp fold
ProfileScan	IPR011761	692	896	PS50975	ATP-grasp fold
ScanRegExp	IPR005479	863	870	PS00867	Carbamoyl-phosphate synthase L chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	881	ELYGVDLLLAAVMVACGLRPALP	903	PRIMARY	23

Primer_f	GCTCCAGGATTATACCACAGT
Primer_r	TCTGCCAATGCTAGTTAGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-