KIAA0656

Product ID	ORK01988
Accession No	AB014556
Description	synaptosomal-associated protein, 91kDa, transcript variant 1
Clone name	hk01789
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4369 bp) Predicted protein sequence (912 aa)
HaloTag ORF Clone	FHC01988
Flexi ORF Clone	FXC01988
Source	Human adult brain
Rouge ID	mKIAA0656 by Kazusa Mouse cDNA Project

Length: 4369 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1402 bp
Genome contig ID	gi89161210r_84219332
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CGCCCTCTGAGATGCAATAAACACCTTGAACAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGCAAACATAACGTTTCTCTCTTTGATTATGTTTGGGAAAAAGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	84319332	84475495	28	99.5	Perfect prediction

Length: 912 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60641	100.0	Clathrin coat a...	Homo sapiens
XP_001085480	99.6	synaptosomal-as...	Macaca mulatta
EAW48656	99.7	synaptosomal-as...	Homo sapiens
CAH92807	98.9	hypothetical pr...	Pongo abelii
CAB89292	99.1	synaptosomal-as...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	0.0009	24.6	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011417	24	290	PF07651	ANTH
HMMSmart	IPR013809	25	150	SM00273	Epsin-like
ProfileScan	IPR013809	19	150	PS50942	Epsin-like

Primer_f	TCTTCCATCCTTCAACTGAGC
Primer_r	CAGCACAGACAGTATGACAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTTCCATCCTTCAACTGAGC
Primer_r	CAGCACAGACAGTATGACAAC
PCR product length	140 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles