KIAA0658

Gene/Protein Characteristic Table for KIAA0658

Order Kazusa clone(s) from :

Product ID	ORK00594
Accession No	AB014558
Description	cryptochrome circadian clock 2
Clone name	hk01862
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk01862 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4103 bp) Predicted protein sequence (589 aa)
HaloTag ORF Clone	FHC00594
Flexi ORF Clone	FXC00594
Source	Human adult brain
Rouge ID	mKIAA0658 by Kazusa Mouse cDNA Project

Length: 4103 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Features of the protein sequence

Description

Length: 589 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q49AN0	100.0	Cryptochrome-2.	Homo sapiens
BAG64048	100.0	unnamed protein...	Homo sapiens
BAF83949	99.8	unnamed protein...	Homo sapiens
XP_001160595	99.7	cryptochrome 2 ...	Pan troglodytes
XP_001113162	98.8	similar to cryp...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR006051	226	487	PD004390	DNA photolyase
HMMPfam	IPR006050	18	185	PF00875	DNA photolyase
HMMPfam	IPR005101	226	503	PF03441	DNA photolyase

Expression profile

Description

RT-PCR

RT-PCR-ELISA

Experimental conditions

Primer_f	CTCGGAACAGTGCCTCAAATC
Primer_r	AACACACCTTCCCAGCAATAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 11

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTCGGAACAGTGCCTCAAATC
Primer_r	AACACACCTTCCCAGCAATAG
PCR product length	105 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp