Gene/Protein Characteristic Table for KIAA0672
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00113
Accession No AB014572
Description Rho GTPase activating protein 44
Clone name hk02382
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4227 bp)
Predicted protein sequence (824 aa)
Flexi ORF Clone FXC00113
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4227 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 824 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11226 0 100.0 Rho GTPase-acti...
synthetic construct
Q17R89 0 99.9 Rho GTPase-acti...
Homo sapiens
XP_001114372 7.3e-216 99.1 similar to nadr...
Macaca mulatta
BAG57745 1.2e-214 99.1 unnamed protein...
Homo sapiens
XP_546629 1.1e-203 94.0 similar to nadr...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051509 0.00094 28.7 KIAA1722
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004148 7 248 PF03114 BAR
IPR000198 275 425 PF00620 RhoGAP
HMMSmart IPR004148 6 248 SM00721 BAR
IPR000198 272 448 SM00324 RhoGAP
ProfileScan IPR004148 20 255 PS51021 BAR
IPR000198 261 451 PS50238 RhoGAP
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f GGGATGTGCAGAGTTTTGATG
Primer_r AGATAACAACTTTCAACCCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f GGGATGTGCAGAGTTTTGATG
Primer_r AGATAACAACTTTCAACCCCC
PCR product length 113 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp