KIAA0724

Gene/Protein Characteristic Table for KIAA0724

Order Kazusa clone(s) from :

Product ID	ORK00615
Accession No	AB018267
Description	importin 13
Clone name	hk02773
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3893 bp) Predicted protein sequence (1047 aa)
HaloTag ORF Clone	FHC00615
Flexi ORF Clone	FXC00615
Source	Human adult brain
Rouge ID	mKIAA0724 by Kazusa Mouse cDNA Project

Length: 3893 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	339 bp
Genome contig ID	gi89161185f_44085198
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ACCCCCCCATCCCCATTAAATTAATCCCAACATGC
Flanking genome sequence (121084 - 121133)	----+--------+--------+--------+--------+----* ATGTATGCATACATTTATTTAATCAACACCGCCGAATATTAGGCCCCTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	44185198	44206280	20	99.8	Perfect prediction

Features of the protein sequence

Description

Length: 1047 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94829	100.0	Importin-13; Sh...	Homo sapiens
AAH08194	99.9	Importin 13 [Ho...	Homo sapiens
BAF82862	99.7	unnamed protein...	Homo sapiens
Q8K0C1	99.2	Importin-13; Sh...	Mus musculus
XP_532612	99.2	similar to Impo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001494	129	195	PF03810	Importin-beta
HMMPfam	IPR013598	200	347	PF08389	Exportin-1/Importin-beta-like
ProfileScan	IPR001494	129	195	PS50166	Importin-beta

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGGATGGGAGGATGCTTGGAC
Primer_r	GATGACACTACTGCAACCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGGATGGGAGGATGCTTGGAC
Primer_r	GATGACACTACTGCAACCACC
PCR product length	161 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp