Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07315 |
---|---|
Accession No | AB018272 |
Description | ubiquitin specific peptidase 34 |
Clone name | hk03615 |
Vector information | |
cDNA sequence | DNA sequence (4143 bp) Predicted protein sequence (1196 aa) |
Source | Human adult brain |
Note | Please refer to "Gene/Protein Characteristic Table for KIAA0570" because the cDNA sequence of KIAA0729 is included in KIAA0570. |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA |
Primer_f | TATGATATGGTGTCCTCTGTG |
---|---|
Primer_r | ACCATTTATATACTGCCAGGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |