Gene/Protein Characteristic Table for KIAA0729
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07315
Accession No AB018272
Description ubiquitin specific peptidase 34
Clone name hk03615
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4143 bp)
Predicted protein sequence (1196 aa)
Source Human adult brain
Note Please refer to "Gene/Protein Characteristic Table for KIAA0570" because the cDNA sequence of KIAA0729 is included in KIAA0570.
Features of the cloned cDNA sequence
Description

Length: 4143 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1196 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAE51938 0 100.0 ubiquitin-speci...
Homo sapiens
Q70CQ2 0 100.0 Ubiquitin carbo...
Homo sapiens
EAW99998 0 100.0 ubiquitin speci...
Homo sapiens
XP_855134 0 99.0 similar to ubiq...
Canis lupus fam...
XP_613697 0 98.6 similar to ubiq...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011142 0 100.0 KIAA0570
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TATGATATGGTGTCCTCTGTG
Primer_r ACCATTTATATACTGCCAGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp