Gene/Protein Characteristic Table for KIAA0731
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05806
Accession No AB018274
Description La ribonucleoprotein domain family, member 1
Clone name hk03714
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4095 bp)
Predicted protein sequence (1096 aa)
Source Human adult brain
Rouge ID mKIAA0731 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4095 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1096 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q6PKG0 0 92.8 La-related prot...
Homo sapiens
EAW61633 0 90.3 La ribonucleopr...
Homo sapiens
AAH01460 0 96.7 La ribonucleopr...
Homo sapiens
XP_001112050 0 95.4 similar to la r...
Macaca mulatta
XP_582017 0 89.3 similar to la r...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006630 407 464 PF05383 RNA-binding protein Lupus La
HMMSmart IPR006630 401 477 SM00715 RNA-binding protein Lupus La
IPR006607 884 925 SM00684 Protein of unknown function DM15
IPR006607 926 964 SM00684 Protein of unknown function DM15
IPR006607 965 1000 SM00684 Protein of unknown function DM15
ProfileScan IPR006630 397 487 PS50961 RNA-binding protein Lupus La
ScanRegExp IPR001199 652 659 PS00191 Cytochrome b5
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCAACTATGCAGCCCACAAGA
Primer_r GTGATGACAAACCCCAGATGA
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f CCAACTATGCAGCCCACAAGA
Primer_r GTGATGACAAACCCCAGATGA
PCR product length 129 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp