KIAA0749

Product ID	ORK04724
Accession No	AB018292
Description	dendrin
Clone name	hk04328
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3628 bp) Predicted protein sequence (678 aa)
HaloTag ORF Clone	FHC04724
Flexi ORF Clone	FXC04724
Source	Human adult brain
Rouge ID	mKIAA0749 by Kazusa Mouse cDNA Project

Length: 3628 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1590 bp
Genome contig ID	gi89161190r_47575397
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CACAGTAGGCGCTCAATAAATCTAAGCTTCCCTTT
Flanking genome sequence (99803 - 99754)	----+--------+--------+--------+--------+----* ATCCAGCCTTGGCATCGTCTTCCTTTCACTGACCCTTTCCCCACAGTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	47675200	47679239	2	100.0	Perfect prediction

Length: 678 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW58031	3.1e-210	100.0	dendrin [Homo s...	Homo sapiens
O94850	9.7e-204	100.0	Dendrin.	Homo sapiens
XP_001105260	2e-200	96.0	dendrin [Macaca...	Macaca mulatta
XP_851155	1.5e-159	77.9	similar to Dend...	Canis lupus fam...
XP_001491757	4.7e-155	81.2	similar to Dend...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GGTCCATCCTTCCGTCTCTGA
Primer_r	TGACTTTGGGTGACACGGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 12

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AAGATAGCGGCCCTGTCACTG
Primer_r	ACGCCTCAGAGCATCACTAAG
PCR product length	140 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles