KIAA0753

Gene/Protein Characteristic Table for KIAA0753

Order Kazusa clone(s) from :

Product ID	ORK00622
Accession No	AB018296
Description	KIAA0753
Clone name	hk04444
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4424 bp) Predicted protein sequence (979 aa)
HaloTag ORF Clone	FHC00622
Flexi ORF Clone	FXC00622
Source	Human adult brain
Rouge ID	mKIAA0753 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4424 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1416 bp
Genome contig ID	gi51511734r_6322375
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACTGTGCTGAGTTTTTAAAATAAACCCAATATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTATGTGCCTATTTTAAATAACTTACATCTCCTTTTTTTCCCACAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	6422375	6484716	19	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 979 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF85565	99.5	unnamed protein...	Homo sapiens
XP_340838	75.5	hypothetical pr...	Rattus norvegicus
AAH43106	75.4	RIKEN cDNA 4933...	Mus musculus
EDL12663	75.0	RIKEN cDNA 4933...	Mus musculus
BAH12465	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GAGGAATCAGGAGAGGACCAG
Primer_r	TCTGTTCCCTACTCCCACTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp